Phusion

Dec 8, 2020

Abstract C-Analogues of the canonical N-nucleosides have considerable importance in medicinal chemistry and are promising building blocks of xenobiotic nucleic acids (XNA) in synthetic biology. Although well established for synthesis of N-nucleosides, biocatalytic methods are lacking in C-nucleoside synthetic chemistry. Here, we identify pseudouridine monophosphate C-glycosidase for selective 5-β-C-glycosylation of uracil and derivatives thereof from pentose 5-phosphate (d-ribose, 2-deoxy-d-ribose, d-arabinose, d-xylose) substrates. Substrate requirements of the enzymatic reaction are consistent with a Mannich-like addition between the pyrimidine nucleobase and the iminium intermediate of enzyme (Lys166) and open-chain pentose 5-phosphate. β-Elimination of the lysine and stereoselective ring closure give the product. We demonstrate phosphorylation-glycosylation cascade reactions for efficient, one-pot synthesis of C-nucleoside phosphates (yield: 33 – 94%) from unprotected sugar and nucleobase. We show incorporation of the enzymatically synthesized C-nucleotide triphosphates into nucleic acids by RNA polymerase. Collectively, these findings implement biocatalytic methodology for C-nucleotide synthesis which can facilitate XNA engineering for synthetic biology applications. Introduction Most natural and synthetic nucleosides (e.g., uridine, U; Fig. 1a ) have their sugar and nucleobase parts connected via a hemiaminal ether (N-glycosidic) linkage. Nucleoside analogs replacing the canonical N- by a rare-to-nature C-glycosidic linkage resist the common routes of biological degradation by N-glycoside hydrolases and phosphorylases 1 , 2 , 3 , 4 . Since in vivo stability is crucial for compound efficacy and applicability in therapy, synthetic C-nucleosides have considerable importance in medicinal chemistry. Nucleoside analogs generally represent promising lead structures in drug design for antiviral, antibacterial and antitumor activity 5 , 6 , 7 , 8 , 9 . Synthetic C-nucleosides, such as BCX4430 (Galidesivir) and GS-6620 (Supplementary Fig. 1 ), can be remarkably effective against filovirus infections and hepatitis C virus, respectively 7 , 10 , 11 , 12 , 13 . Originally developed for use against filoviruses, GS-5734 (Remdesivir; Supplementary Fig. 1 ) is now also evaluated against infections of the SARS-CoV-2 virus 10 , 13 , 14 . Other C-nucleosides, such as showdomycin, formycin, pseudouridimycin and minimycin (Supplementary Fig. 1 ), constitute an emerging class of microbial natural products that exhibit unusual structures and diverse biological activities, including antibiotic efficacy 15 , 16 , 17 , 18 , 19 , 20 , 21 . Fig. 1: Proposed reaction mechanism of YeiN and the enzymatic phosphorylation-glycosylation cascade used in this study. The N-nucleoside uridine (U) (a) compared to the C-nucleoside pseudouridine (Ψ) (b) and reverse reaction of YeiN for synthesis of Ψ 5’-phosphate (ΨMP) from d-Rib5P (1) and Ura (12) (c). In panel c, B is the base residue from the enzyme. The key catalytic steps are the following: formation of a covalent iminium ion intermediate between the enzyme (Lys166) and the open-chain d-Rib5P, assisted by Glu31 (I); Mannich-like reaction for C-C coupling (II); β-elimination of the amine of Lys166 (III); cyclization through an oxa-Michael addition-like reaction (IV). For further discussion of the enzyme mechanism, see the text under the Results and the Discussion. d Phosphorylation-glycosylation cascades for one-pot synthesis of ΨMP and Ψ 5’-triphosphate (ΨTP) from unphosphorylated d-Rib are shown. Dephosphorylation of ΨMP yields Ψ. RbsK d-Rib-5-kinase, PK pyruvate kinase, CIP calf intestine phosphatase, NDK nucleoside diphosphate kinase. PEP phosphoenolpyruvate, PYR pyruvate. C-nucleosides are furthermore important as natural or synthetic building blocks of nucleic acids, RNA in particular. The U isomer pseudouridine (Ψ; Fig. 1b ) occurs naturally in all types of RNA (tRNA, rRNA, snRNA, snoRNA, scaRNA, and mRNA) 22 , 23 , 24 , 25 , 26 . The Ψ formation is catalyzed by Ψ-synthase, which post-translationally isomerizes U to Ψ 27 , 28 . Owing to additional hydrogen bonding from the nucleobase N1 in Ψ compared to U (Fig. 1a, b ), positional substitution of U with Ψ can increase RNA stability by locally enhancing the macromolecular rigidity 23 . Chemically synthesized Ψ and derivatives thereof are important building blocks for study of C-nucleoside biology as well as for numerous synthetic biology applications based on xenobiotic nucleic acids (XNA) 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 . For example, the uniform substitution of U by Ψ can render synthetic mRNA non-immunogenic and was shown to enhance the translation efficiency 30 , 31 , 32 . Additionally, Ψ-modified mRNA can boost the gene-cutting efficiency in CRISPR-based gene editing 37 , 38 . To advance C-nucleosides for their emerging applications in XNA engineering or in drug design, the target compounds must be made available through efficient and structurally precise synthetic methods. Chemical routes to C-nucleosides typically follow the synthetic rationale of (1) reconstructing the heteroaryl nucleobase on a C1′-functionalized sugar or (2) coupling the prepared heteroaryl with a suitable glycosyl reagent, such as a hydroxy group-protected glycal or pentonolactone 5 , 39 , 40 , 41 , 42 , 43 . However, despite much progress from research over decades, a purely chemical approach to defined C-nucleosides remains challenging to establish 44 , 45 , 46 , 47 , 48 , 49 , 50 . A synthesis that exploits the high stereo- and regiocontrol of enzymatic reactions for installing the C-glycosidic linkage would be highly desirable. Natural enzymes of C-glycoside biosynthesis, such as tRNA pseudouridine synthase 27 , 28 , 51 , 52 and C-glycosynthase 15 , 18 , 19 , 20 , 21 , 53 , 54 have complex substrate requirements, leading to perceived limitations on their applicability. Therefore, unlike N-nucleosides for which N-nucleoside phosphorylases present excellent tools of glycoside synthesis 55 , 56 , 57 , 58 , 59 , 60 , biocatalytic methods are lacking for C-nucleoside synthetic chemistry. Here, we identify pseudouridine monophosphate (ΨMP) C-glycosidase for C-nucleoside synthesis. The enzyme’s natural role is the recycling of Ψ via degradation of its 5′-phosphate into uracil (Ura(12)) and d-ribose 5-phosphate (d-Rib5P(1)), as shown in Supplementary Fig. 2 61 , 62 . Despite early evidence suggesting applicability 63 , 64 , 65 , the reverse C-glycosidase reaction (Fig. 1c ) is unexplored synthetically. Multiplicity of enzymes in C-nucleoside turnover and overlapped enzyme naming used previously complicate clear assignment of enzyme type to function. For this study, we use the biochemically and structurally well-characterized ΨMP C-glycosidase from E. coli (YeiN). We show that YeiN catalyzes the selective 5-β-C-glycosylation of Ura (12) and derivatives thereof from several pentose 5-phosphate substrates, including the 5-phosphate of d-ribose, 2-deoxy-d-ribose, 2-deoxy-2-fluoro-d-ribose, d-arabinose or d-xylose. The ΨMP and its corresponding sugar or nucleobase variants are obtained in a single-step, highly efficient transformation. Remarkably, although formally a reversion of hydrolysis, the overall enzymatic conversion benefits from the favorable thermodynamics of its central catalytic step, a carbon-carbon bond-forming (Mannich-like) addition. It thus proceeds with excellent synthetic yields (≥90%), even in water. Finally, we show incorporation of the enzymatically synthesized C-nucleotide triphosphates into RNA. Collectively, therefore, our study implements biocatalytic methodology for C-nucleotide synthesis, which can facilitate XNA engineering for synthetic biology applications and establish new routes to natural product C-glycosides. Results The substrate scope of YeiN in reverse C-glycosidase reaction Figure  2 shows the substrates used. Besides the native substrates d-Rib5P (1) and Ura (12), we tested a series of sugar phosphates (in combination with Ura, 12) and nucleobase analogs (in combination with d-Rib5P, 1) as alternative substrates (Fig. 2 ) of C-glycosylation by YeiN. Based on product formation detected with HPLC, 2-deoxy-d-Rib5P (d-dRib5P, 2), d-xylose 5-phosphate (d-Xyl5P, 3), d-arabinose 5-phosphate (d-Ara5P, 4) and 2-deoxy-2-fluoro-d-ribose 5-phosphate (2F-d-Rib5PP, 5) are active. l-Ribose 5-phosphate (l-Rib5P, 6), d-glucose 6-phosphate (d-Glc6P, 7), d-mannose 6-phosphate (d-Man6P, 8), d-fructose 6-phosphate (d-Fru6P, 9), d-ribulose 5-phosphate (d-Rul5P, 10) and d-erythrose 4-phosphate (d-Ery4P, 11) are inactive. We also considered the 5-phosphates of 2-amino-2-deoxy- and 3-amino-3-deoxy-d-ribose, l-arabinose, d-lyxose, and l-xylose (Supplementary Fig. 3 ), but enzymatic phosphorylation of these pentoses from ATP proved not possible. The nucleobase analogs used for reaction with YeiN feature substitutions at each Ura carbon (Fig. 2 ). 3-Methyl-Ura (13), 6-amino-Ura (14), 4-thio-Ura (15) and 2-thio-Ura (16) are active. Absence of activity with 1-methyl-Ura (17), 5-fluoro-Ura (18) and 6-trifluoro-methyl-Ura (19) can be mechanistically relevant, as discussed below. Additionally, thymine (5-methyl-Ura, 20), 6-aza-Ura (21), 6-Cl-Ura (22), cytosine (23), 2,4-thio-Ura (24), 5-ethynyl-Ura (25), maleimide (26), adenine (27), guanine (28), 4-pyrimidone (29) and pyrimidine (30) were evaluated but found to be inactive. Combinatorial assessment of all sugar 5-phosphates active with Ura (12) against the full panel of Ura analogs used with d-Rib5P (1) confirms the substrate scope of YeiN (Supplementary Table  1 ). Fig. 2: Substrate scope of YeiN. Substrates tested for C-glycosylation by YeiN. The compounds framed in blue are active while those framed in magenta are not. Densitometric analysis of gel bands suggested that RNA polymerase transcription efficiency (expressed as gel band intensity) was similar when ΨTP was used to substitute UTP. Unexpectedly, the band intensity decreased to about half when ΨTP and UTP were added at the same time. Overloading of the RNA polymerase with NTP substrate may have caused inhibition, perhaps due to limitation in the concentration of Mg2+ used. 6-Amino-ΨTP and dΨTP were not accepted by the used RNA polymerase. Applying DreamTaq-polymerase that is known for its relaxed dNTP substrate specificity, we observed that dΨTP cannot substitute for dTTP (Fig. 6b ). However, when used together with dTTP, the dΨTP appeared to inhibit the amplification slightly (∼25%). Discussion We here demonstrate the reverse reaction of ΨMP C-glycosidase for efficient biocatalytic synthesis of C-nucleoside monophosphates. Besides the natural ΨMP, a panel of sugar and nucleobase analogs of the C-nucleoside monophosphate are synthesized with excellent regiocontrol and stereoselectivity. The substrate requirements of the enzymatic reaction are consistent with the mechanistic proposal (Fig. 1c ) of a Mannich-like C-C addition between the iminium ion of an enzyme bound open-chain pentose 5-phosphate intermediate and the pyrimidine nucleobase. β-Elimination of the enzyme residue and stereospecific cyclization via oxa-Michael-like addition give the C-nucleoside monophosphate product. Use of the iminium ion intermediate as an electrophile of the reaction distinguishes YeiN from well-studied aldolases that form essentially the same covalent intermediate but convert it to an enamine nucleophile for aldol coupling. Chemical studies of C-glycoside synthesis have shown that the condensation product is favored thermodynamically, even in water 77 , 78 , and the synthetic use of the chemical reaction was demonstrated 73 , 74 , 75 , 76 , 77 . Equilibrium on the YeiN reaction far on the side of the C-nucleoside monophosphate, which would seem unusual for a nominal glycosidase reaction, is thus explained. Enzymatic C–C coupling reactions are synthetically important in the carbohydrate sciences 65 , 78 , 79 , 80 , 81 , 82 , 83 , 84 , 85 , 86 and the current study adds new application-relevant feature to them. The development of enzymatic phosphorylation-glycosylation cascade reactions enable expedient, one-pot biocatalytic syntheses of the C-nucleoside 5′-phosphates from unphosphorylated pentoses as the substrates (Fig. 1d ). We show that the C-nucleoside 5′-phosphates are readily dephosphorylated to give the C-nucleoside and that they can also be converted into the corresponding 5′-triphosphates. The non-phosphorylated C-nucleoside and its 5′-triphosphate are promising substrates for chemical and polymerase-catalyzed XNA synthesis, respectively. Phosphorylation-glycosylation cascades extend the synthetic utility of the ΨMP C-glycosidase reaction, enabling C-nucleoside phosphates to be obtained from unprotected sugar and nucleobase. The ΨMP C-glycosidases are related evolutionary to a class of C-glycosynthases, represented by the well-characterized AlnA from Streptomyces sp. CM020, that catalyze β-C-riboside formation from d-Rib5P (1) and different naphthoquinones (Supplementary Fig. 7 ) 53 , 54 , 87 . The herein developed idea of modular phosphorylation-glycosylation cascades could be analogously applied to AlnA-type C-glycosynthases, to also harness these enzymes’ catalytic proficiency and substrate promiscuity for practical synthesis. Methods Materials ATP ( > 95% purity) was from Roth (Karlsruhe, Germany). Deuterium oxide (99.96%) was from Euriso-Top (Saint-Aubin Cedex, France). Calf intestine phosphatase (CIP) was from New England Biolabs (Frankfurt am Main, Germany). Rabbit muscle pyruvate kinase (PK), adenosine triphosphate (ATP), d-ribose (d-Rib), d-2-deoxy-ribose (d-dRib), d-xylose (d-Xyl), d-arabinose (d-Ara), d-mannose (d-Man), d-glucosamine (d-GlcN), N-acetyl-d-glucosamine (d-GlcNAc), d-galactose (d-Gal), d-galactosamine (d-GalN), d-lyxose (d-Lyx), l-arabinose (l-Ara), l-xylose (l-Xyl), d-ribose-5-phosphate (d-Rib5P(1)), d-fructose 6-phosphate d-Fru6P(9), d-mannose 6-phosphate (d-Man6P (8)), d-glucose 6-phosphate (d-Glc6-P (7)), d-erythrose 4-phosphate (d-Ery4P (11)), d-ribulose 5-phosphate (d-Rul5P (10)), uracil (Ura (12)), 6-amino-Ura (14), 4-thio-Ura (15), 2-thio-Ura (16), 6-trifluoromethyl-Ura (19), 1-methyl-uracil (17), pyrimidine (29), pyrimidone (30), maleimide (26), adenine (27), guanin (28), thymine (20), and cytosine (23) were from Sigma Aldrich (Vienna, Austria). 3-Methyl-Ura (13), 6-aza-Ura (21), 6-Cl-Ura (22), and l-ribose 5-phosphate (6) were from Carbosynth (Compton, UK). 2-Amino-2-deoxy-d-ribose (2A-d-Rib), 3-amino-3-deoxy-d-ribose (3A-d-Rib), and 2-deoxy-2-fluoro-d-ribose (2F-d-Rib)) were from Synthose (Concord, Ontario, Canada). Expression vectors (pet15b) containing the genes for ribokinase (RbsK) or β-pseudouridine 5′-phosphate glycosidase (YeiN) were obtained from Genescript (Leiden, The Netherlands). Restriction enzymes, Phusion polymerase, T7 RNA Polymerase, Dream Taq DNA polymerase, and GenJET® PCR clean-up kit were from Thermo Fisher Scientific (Altham, MA, USA). DNA sequencing was done at LGC Genomics (Berlin, Germany). Ψ-5’-phosphate glycosidase (YeiN) An N-terminally His6-tagged E. coli YeiN was used. The expression vector (pet15_yein) as obtained from Genescript was transformed into the E. coli BL21_DE3 (pLys) expression strain by electroporation and transformants were selected on 0.1 mg/mL ampicillin LB-agar plates. YeiN was expressed in 1-L baffled shaken flasks at 37 °C and 110 rpm using 250 mL Lennox-media containing 0.1 mg/mL of ampicillin. Inoculation was to an initial OD600 of 0.1. At an OD600 of 0.8, the temperature was decreased to 18 °C and gene expression was induced with 0.4 mM IPTG (isopropyl β-d-1-thiogalactopyranoside) for 20 h. Cells were harvested by centrifugation at 2000 × g at 4 °C for 30 min using a Sorvall RC-5B refrigerated superspeed centrifuge (Du Pont Instruments, Newtown, CT, USA). The supernatant was discarded, and the pellet was suspended in 50 4-(2-hydroxyethyl) piperazine-1-ethanesulfonic acid (HEPES) buffer (pH 8.0). Cells were disrupted using sonication (Fisherbrand Sonic Dismembrator, model Ultrasonic Processor FB-505; Fisher Scientific, Vienna, Austria; 5 min) on ice and the cell-free supernatant was recovered by centrifugation at 4 °C and 2000 × g for 30 min. Pre-treated cell lysate (20 mL) was loaded on 2 × 5 mL HisTrap FF column (GE Healthcare, Little Chalfont, UK), equilibrated with buffer A (50 mM HEPES, pH 8.0 containing 125 mM NaCl, 20 mM imidazole) and mounted on an ÄKTA prime plus (GE Healthcare) system. Protein was eluted using an imidazole gradient from 0% to 80% buffer B (50 mM HEPES, pH 8.0, containing 125 mM NaCl and 500 mM imidazole). The temperature was 10 °C and a flow rate of 3 mL/min was used. Fractions containing the target protein were pooled, concentrated and buffer-exchanged with Amicon Ultra-15 Centrifugal Filter Units (Millipore; Billerica, MA, USA). The final protein concentration was 30 mg/mL in 50 mM HEPES buffer containing 2 mM MgCl2 (pH 7.0). Enzyme was stored at −20 °C until further use. Protein purification was monitored by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS PAGE) (Supplementary Fig. 34 ). The YeiN activity assay was performed at 37 °C in 50 mM HEPES buffer supplemented with 2 mM MnCl2 (pH 7.0). About 1.5 µM YeiN was used in the reaction. The substrates used were d-Rib5P (1) (2 mM) and Ura (12) (1 mM). One unit of YeiN activity is the amount of enzyme producing 1 μmol of ΨMP/min under the conditions used. Enzyme preparations had typically a specific activity of ∼3 U/mg. Ribokinase (RbsK) The expression vector (pet15_RbsK) as obtained from Genescript was transformed into the E. coli BL21_DE3 (pLys) expression strain by electroporation and transformants were selected on 0.1 mg/mL ampicillin LB-agar plates. RbsK was expressed and purified as described for YeiN, except the protein was stored in 50 mM HEPES supplemented with 2 mM MgCl2 (pH 7.0). An N-terminally His6-tagged E. coli RbsK was used. The RbsK activity assay was performed at 37 °C in 50 mM HEPES buffer (pH 7.0, pH adjusted with KOH) containing 2 mM MgCl2 and 3 µM RbsK. The substrates used were ATP (10 mM) and d-Rib (10 mM). One unit of RbsK activity is the amount of enzyme producing 1 μmol of d-Rib5P (1)/min under the conditions used. The enzyme preparation had a specific activity of ∼50 U/mg. Pentose-5-phosphate phosphatase BT4131 The sugar phosphate phosphatase BT4131 from Bacteroides thetaiotaomicron VPI-5482 was used as an N-terminal fusion with the positively charged binding module Zbasic2 88 . Expression, harvest and cell disruption was performed as described for YeiN except 50 µg/mL kanamycin was used instead of ampicillin. Cell-free extract (20 mL) was loaded on 2 × 5 mL HiTrap SP FF column (GE Healthcare), equilibrated with buffer A (50 mM MES buffer, pH 7.0, containing 100 mM NaCl) and mounted on an ÄKTA prime plus (GE Healthcare) system. Protein was eluted using an NaCl gradient from 0% to 100% buffer B (50 mM HEPES buffer supplemented with 2 M NaCl, pH 7.0) at 10 °C using a flow rate of 3 mL/min. Fractions containing the target protein were pooled, concentrated and buffer-exchanged with Amicon Ultra-15 Centrifugal Filter Units (Millipore; Billerica, MA, USA). The final protein concentration was 10 mg/mL in 50 mM HEPES containing 2 mM MgCl2 (pH 7.0). The enzyme was stored at 4 °C until further use. Protein purification was monitored using SDS PAGE. The specific activity was determined in 50 mM HEPES buffer supplemented with 5 mM MgCl2 (pH 7.0) at 37 °C using 20 mM d-Glc6P as the substrate. The reaction was started with 1.5 µM BT4131 and samples taken were quenched by heat treatment. Inorganic phosphate was measured at 850 nm 88 . One unit of BT4131 activity is the enzyme amount releasing 1 μmol of phosphate from d-Glc6P/min under the conditions applied. The specific activity of the phosphatase preparation was typically ∼16 U/mg. Nucleoside monophosphate kinases (NPK) The uridine monophosphate kinase (umpk) and cytidine monophosphate kinase (cmpk) genes were amplified from genomic E. coli BL21_DE3 (pLys) DNA by PCR using Phusion polymerase and the following set of primers (restriction sites underlined): UMPK_NdeI_fw (CATATGGCTACCAATGCAAAACCCGTC), UMPK_XhoI_rv (CTCGAGTTATTCCGTGATTAAAGTCCCTTCTTTTTC); CMPK_NdeI_fw (CATATGACGGCAATTGCCCCGGTTATTACC), CMPK_XhoI_rv (CTCGAGTTATGCGAGAGCCAATTTCTGGCGC). Doubly digested (NdeI and XhoI) PCR products were purified from agarose gels treated with shrimp alkaline phosphatase (NEB, Ipswich, MA, USA) and ligated (T4 ligase) into the linearized (NdeI and XhoI) pET-STREP3 expression vector. The constructed vector was transformed into electro-competent E. coli BL21_DE3 (pLys) and transformants were selected on LB-agar plates (0.05 mg/mL kanamycin). Isolated vectors were sequenced (LGC Genomics). NPK expression, cell harvesting and cell disruption was performed as described for YeiN, except that 0.05 mg/mL kanamycin instead of ampicillin was used and cells were dissolved in wash buffer (100 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM EDTA). Cell-free extract (20 mL) was loaded (2 mL/min) on 1 × 5 mL StrepTrap HP column (GE Healthcare), equilibrated with wash buffer and mounted on an ÄKTA prime plus (GE Healthcare) system. Unspecifically bound protein was washed off with 10 column volumes of wash buffer at a flow of 3 mL/min. Protein was eluted using elution buffer (100 mM Tris-Cl pH 8.0, 150 mM NaCl, 1 mM EDTA, 2.5 mM desthiobiotin). Fractions containing the target protein were pooled, concentrated and buffer-exchanged with Amicon Ultra-15 Centrifugal Filter Units (Millipore). The final protein concentration was 15 mg/mL in 50 mM HEPES containing 2 mM MgCl2 (pH 7.0). Enzyme was stored at −20 °C until further use. Protein purification was monitored using SDS PAGE (Supplementary Fig. 34 ). The UMPK was only weakly expressed and most of the recombinant enzyme was found in inclusion bodies. An N-terminally strep-tagged CMPK was used. The NPK-assay was performed at 37 °C in 50 mM HEPES buffer (pH 7.0) containing 1 mM MgCl2 and 5 µM CMPK. The substrates used were 3 mM UMP and 3 mM ATP. One unit of NPK activity is the amount of enzyme producing 1 μmol of UDP/min under the conditions used. CMPK preparation typically exhibited a specific activity of 20 U/mg. Nucleoside diphosphate kinase (NDK) An N-terminally Strep-tagged variant was used. The ndk gene was amplified from genomic E. coli BL21_DE3 (pLys) DNA by PCR using Phusion polymerase and the following set of primers (overlapping 5'-overhangs in lower case letters): NDK_fwd (ATGGCTATTGAACGTACTTTTTCCATC), NDK_rv (TTAACGGGTGCGCGGGC). The PCR product was cloned into the pET-STREP3 expression vector by circular polymerase extension cloning. Briefly, using the primer pairs CEPEC_NDK_fwd (GTTCGAGAAAGGCTTAATTAACCATATGgctattgaacgtactttttccatc), CPEC-NDK_rv (GTGGTGGTGGTGGTGCTCGAGttaacgggtgcgcgggc) and CPEC-NDK-Strep_fwd (ggaaaaagtacgttcaatagcCATATGGTTAATTAAGCCTTTCTCGAAC) CPEC-NDK-Strep_rv (gcccgcgcacccgttaaCTCGAGCACCACCACCACCAC) in two independent PCR reactions, complementary overlaps are introduced into the ndk gene and into the target vector. The purified PCR products were used in an overlap-extension-PCR to prime each other and to create the final expression vector, which was transformed into E. coli XL1 Blue. Transformants were selected on LB-agar plates containing 0.1 mg/mL of ampicillin, and the isolated plasmid was sequenced. The sequenced vector was transformed into the expression strain E. coli BL21_DE3 (pLys) and transformants were selected on LB-agar plates containing 0.1 mg/mL of ampicillin. NDK expression and purification were as described for NDKs (Supplementary Fig. 34 ). The NDK activity assay was performed at 37 °C in 50 mM HEPES buffer (pH 7.0) containing 1 mM MgCl2 and 5 µM NDK. The substrates used were 3 mM uridine diphosphate (UDP) and 3 mM ATP. One unit of NDK activity is the amount of enzyme producing 1 μmol of UTP/min under the conditions used. The enzyme preparation had a specific activity of 21 U/mg. Determination of protein concentration Protein concentrations were measured using DS-11 Spectrophotometer (DeNovix; Wilmington, DE, USA) at 280 nm. Protein concentration was calculated using the corresponding molar extinction coefficient and the molecular weight computed by protparam ( https://web.expasy.org/protparam/ ). RbsK (12,490 M−1cm−1, 32,290 Da), YeiN (10,095 M−1cm−1, 32,909 Da), CMPK (13,075 M−1cm−1, 25,970 Da), NDK (4470 M−1cm−1, 15,463 Da), BT4131 (14,690 M−1cm−1, 28,856 Da). Determination of nucleotide concentration Uracil content was measured photometrically using a DS-11 Spectrophotometer (DeNovix). Ura (12) (260 nm, 10 absorbance units (AU) mM−1 cm−1), 4-thio-Ura (15) (270 nm, 22 AU mM−1 cm−1), 2-thio-Ura (16) (273 nm, 12 AU mM−1 cm−1), thymidine (20) (260 nm, 8.9 AU mM−1 cm−1), guanine (28) (246 nm, 10.7 mM−1 cm−1), cytosine (23) (267 nm, 6.1 mM−1 cm−1), adenine (27) (260 nm, 13 mM−1 cm−1). High-performance liquid chromatography (HPLC) Nucleosides were quantified by reversed-phase ion-pairing HPLC. Typically, 5 µL of sample containing an overall nucleoside concentration of about 1 mM were loaded on a Kinetex C18 column (Phenomenex, Aschaffenburg, Germany; 5 µm, 100 Å, 50 × 4.6 mm). Analytes were separated in 5-min long isocratic runs using 20 mM phosphate buffer, pH 5.9, containing 40 mM tetra-n-butylammonium bromide (TBAB) and 12.5% acetonitrile. The flow rate was 2 mL/min and the temperature set to 35 °C. Eluents were detected at 260 nm. A 5-min HPLC trace is shown in Supplementary Fig. 35 . Typical retention times were as follows: Ura (12) (0.3 min), ΨMP (0.4 min), ΨDP (0.9 min), ADP (1.1 min), ΨTP (2.7 min), and ATP (4 min). Thin-layer chromatography (TLC) About 1–2 µL sample were spotted onto a TLC plate (Merk, Darmstadt, Germany). The mobile phase was composed of 2-BuOH:AcOH:H2O (2:1:1). The development solution consisted of 0.5 g thymol, 95 mL EtOH and 5 mL H2SO4. Reducing sugar spots were developed by heating the plate to approximately 70 °C for 2 min using a heat-gun (Supplementary Fig. 33 ). Synthes is and isolation of pentose 5-phosphates Prior to synthesis, the substrate scope of RibK was evaluated using mixture of 100 mM sugar (d-Rib, d-dRib, d-Xyl, d-Ara, 2F-d-Rib, d-Glc, 2F-d-Rib, 3A-d-Rib, l-Xyl, l-Ara, d-Lyx, d-Man, d-GlcN, d-GlcNAc, d-GlcA, d-Gal, d-GalN), 100 mM PEP, 2 mM ATP and 10 mM HEPES buffer (pH 7.0) containing 1 mM MgCl2 and enzymes (60 µM RbsK, 0.4 µM PK) in a total volume of 100 µL. The reactions were incubated at 37 °C without agitation for 20 h and 5 µL sample were analyzed by TLC. Of the tested sugars, d-Rib, d-dRib, d-Xyl, d-Ara,2F-d-Rib, d-Glc were accepted. Synthesis was performed at 5 mL scale, except for 2-deoxy-2-fluoro-d-Rib 5-phosphate (2F-D-Rib5P (5) that was prepared in a 1 mL reaction. Reaction mixtures contained 100 mM pentose (d-Rib, d-dRib, d-Xyl, d-Ara, 2F-d-Rib), 100 mM PEP, 2 mM ATP in 10 mM HEPES buffer (pH 7.0) with 1 mM MgCl2 and 0.4 µM PK. For the phosphorylation of d-Rib, 15 µM RbsK, for d-dRib 30 µM RbsK, and for other pentoses 60 µM RbsK were used. The reactions were incubated at 37 °C without agitation for 20 h and 5 µL sample were analyzed by TLC. The reaction was stopped by heat treatment at 99 °C for 10 min and precipitated protein was removed by centrifugation for 10 min at 4 °C and 16,000 × g. The reactions were diluted with twice volume of water and applied (20 mL; 2 mL/min) to a FliQ FPLC column (10 mL; 104 × 11.0 mm; Generon, Maidenhead, U.K.) packed with SuperQ-650M (Tosh, Tokyo, Japan) anion exchange resin mounted onto an ÄKTA prime plus FPLC system (GE Healthcare). The column was equilibrated in 10 mM sodium acetate (NaAc), pH 4.5. Products were eluted using a linear gradient of 1 M NaAc (pH 4.5), from 0% to 50% in 120 mL with a flow of 4 mL/min. Eluting fractions were evaluated for the presence of sugar phosphates using TLC. Following the product elution, the column was regenerated with 100% of 1 M NaAc buffer for 10 min. The fractions containing pentose 5-phosphates were pooled and concentrated under reduced pressure (20 mbar, 40 °C) to a total volume of 1 mL using a rotary evaporator (Laborta 500-efficient; Heidolph Instruments, Schwabach, Germany). The concentration of pentose 5-phosphates were evaluated as follows: sugar phosphates were completely hydrolyzed by applying 10 µM of sugar phosphate phosphatase (AGP) 88 for 20 h. The released inorganic phosphate was determined in a colorimetric assay based on the formation of a blue phospho-molybdate complex at 850 nm 89 . Screening sugar phosphate and nucleobase substrates All reactions were performed at 37 °C in 50 mM HEPES buffer (pH 7.0) containing 2 mM MnCl2 in a total volume of 100 μL. Nucleobase screening was performed by incubating 5 mM d-Rib5P (1) and 1 mM of nucleobase (Ura (12), 3-methyl-Ura (13), 6-amino-Ura (14), 2-thio-Ura (15), 4-thio-Ura (16), 1-methyl-Ura (17), 5-fluoro-Ura (18), 6-trifluoro-methyl-Ura (19), 6-aza-Ura (21), 6-Cl-Ura (22), 2,4-dithio-Ura (24), 5-ethynyl-Ura (25), maleimide (26), cytosine(23), thymine (20), adenine (27), guanine (28), 4-pyrimidone (29) and pyrimidine (30)) with 30 µM YeiN. Sugar phosphates were screened by incubating 1 mM Ura and 5 mM of sugar phosphate (d-Rib5P (1), d-dRib5P (2), d-Xyl5P (3), d-Ara5P (4), d-Fru6P (9), d-Man6P (8), d-Glc6P (7), d-Rul (10), d-Ery4P (11), 2F-d-Rib5P (5), l-Rib5P (6) with 30 µM YeiN. Samples (20 µL) were withdrawn after 0, 3, 24 h and quenched by methanol addition (100 µL). Precipitated protein was removed by centrifugation at 20,000 × g for 5 min and supernatant was analyzed by HPLC. Five millimolar of pentose phosphates (previously isolated as described above) accepted by YeiN in the initial screen (d-Rib5P (1), d-dRib5P (2), d-Xyl5P (3), d-Ara5P (4), d-2F-Rib5P(5)) were incubated with 2 mM of each nucleobase (Ura (12), 3-methyl-Ura (13), 6-amino-Ura (14), 2-thio-Ura (15), 4-thio-Ura (16), 1-methyl-Ura (17), 5-fluoro-Ura (18), 6-trifluoro-methyl-Ura (19), 6-aza-Ura (21), 6-Cl-Ura (22), 2,4-dithio-Ura (24), 5-ethynyl-Ura (25), maleimide (26), cytosine(23), thymine (20), adenine (27), guanin (28), 4-pyrimidone (29) and pyrimidine (30)) and 30 µM of YeiN for 3 h. The reactions were quenched by methanol addition (500 µL) and precipitated protein was removed by centrifugation at 20,000 × g for 5 min prior to HPLC analysis. YeiN kinetics The rate constant kcat and the Michaelis constant KM were determined by measuring the initial rate of ΨMP synthesis catalyzed by YeiN (1 µM–120 µM) in 50 mM HEPES (pH 7.0) supplemented with 2 mM MnCl2. Reactions were incubated at 37 °C on a Thermomixer comfort (Eppendorf, Hamburg, Germany) with agitation of 300 rpm. Initial rates for ΨMP synthesis with nucleobases (Ura (12), 6-amino-Ura (13), 4-thio-Ura (14), 2-thio-Ura (15), 3-methy-Ura(16)) were determined at a constant d-Rib5P (1) concentration of 5 mM and at nucleobase concentrations between 0.05 mM and 1.00 mM. Initial rates for ΨMP synthesis with pentose 5-phosphates (d-Rib5P (1), d-dRib5P (2), d-Ara5P (4), d-Xyl5P(3) were determined at a constant Ura (10) concentration of 5 mM and 1.00−0.05 mM of the corresponding pentose 5-phosphate. Reactions were started by YeiN (1.00 µM−100 µM) added in a concentration adjusted to the enzyme’s specific activity with the substrate used. The reaction mixture was incubated for 20 min and quenched by methanol addition (1:1, v:v). Precipitated protein was removed by centrifugation at 20,000 × g for 5 min and samples were analyzed by HPLC. It was ensured that conversion was below 20%. Kinetic parameters were obtained from non-linear least squares fits (SigmaPlot; Systat, Erkrath, Germany) of initial ΨMP-synthesis rates to Michaelis–Menten Eq. ( 1 ). V is the initial rate, Vmax is the maximum initial rate, KM is the Michaelis constant and [S] is the initial substrate concentration. The kcat was determined from the relationship kcat = Vmax/[E], where [E] is the molar enzyme concentration. [E] was determined from the protein concentration and enzyme molecular weight. $$V = \frac{{V_{max}[S]}}{{(K_M + [S])}}$$ (1) Synthesis of ΨMP derivatives Synthesis of ΨMP derivatives was performed in two steps in one pot. Reactions were started by addition of enzyme. All reactions were incubated at 37 °C without agitation. Step one: pentose phosphorylation. The reaction mixture contained 100 mM pentose (d-Rib, d-dRib, d-Xyl, d-Ara, 2F-d-Rib), 100 mM PEP, 2 mM ATP and 10 mM HEPES buffer (pH 7.0), 1 mM MgCl2 and 0.4 µM pyruvate kinase. For the phosphorylation of d-Rib 15 µM RbsK, for d-dRib 30 µM RbsK and for d-Ara and d-Xyl 60 µM RbsK was used. Reactions were performed in a total volume of 5 mL. Samples (5 µL) were taken at reaction start and then after 2 h and 20 h. They were analyzed by TLC. Step two: C-glycosylation using YeiN. After phosphorylation, the reaction mixture was diluted to a final concentration of 25 mM pentose 5-phosphate (d-Rib5P (1), d-dRib5P (2), d-Xyl5P (3), d-Ara5P(4)) using 10 mM HEPES (pH 7.0). Ten mM of nucleobase (Ura (12), 6-amino-Ura (13), 2-thio-Ura (14), 4-thio-Ura (15), 3-methyl-Ura (16)) were added to the phosphorylation reaction. ΨMP-synthesis was started with 15 µM YeiN. To compensate for the lower activity of YeiN towards different pentose 5-phosphates and nucleobases, the YeiN concentration was adjusted as follows: for the synthesis of dΨMP 30 µM YeiN was used; for synthesis of Ara-ΨMP, Xyl-ΨMP, 6-amino-ΨMP, 2-thio-ΨMP and 4-thio-ΨMP, 90 µM YeiN was used. Samples (5 µL) were taken at start and after 5, 15, 30, 60, 120, 180, 240, 300, 360 min, and 10 h for 2-thio-ΨMP, Ara-ΨMP, Xyl-ΨMP. Each sample was quenched by 100 µL methanol. Precipitated protein was removed by centrifugation for 20,000 × g for 5 min and the sample was analyzed by HPLC. After completion of the reaction or latest after 10 h of incubation, the reactions were stopped by heat inactivation for 5 min at 99 °C. Precipitated protein was removed by centrifugation for 10 min at 4 °C and 16,000 × g. ΨMP dephosphorylation ΨMP (5 mM) was dissolved in 15 mL 10 mM HEPES buffer, pH 8.0, supplemented with 1 mM MgCl2 and incubated with 2 U/mL of CIP at 37 °C for 600 min. Ten microliters samples were withdrawn at start, and after 30, 90, 600 min, and quenched in 100 µL methanol. Precipitated enzyme was removed by centrifugation (16,000 × g, 4 °C, 5 min) and supernatant was analyzed by HPLC. CMPK, NDK, PK, phosphorylation cascade The reaction set-up consisted of 0.5 mM ATP, 5 mM purified ΨMP, 12 µM CMPK, 1 mM MgCl2, 30 µM PK, 12 mM PEP, 50 mM HEPES, pH 7.0, in a total volume of 250 µL. Ten µL samples taken at certain times were quenched in 100 µL methanol. The precipitated enzyme was removed by centrifugation (20,000 × g, 4 °C, 5 min) and supernatant was analyzed by HPLC. To test the effect of NDK removal for ΨTP-synthesis the same reaction set up without addition of 40 µM NDK was used (Supplementary Fig. 31 ). One-pot multistep enzymatic synthesis of Ψ-triphosphates Pentose phosphorylation was performed as described above under “Step one: pentose phosphorylation”. For ΨMP synthesis, 15 mM nucleobase (Ura (12), 6-amino-Ura (13), 2-thio-Ura (14), 4-thio-Ura (15), 3-methyl-Ura (16)), 1 mM MnCl2, and 10 mM HEPES buffer were added to the reaction mixture to a final concentration of 25 mM pentose 5-phosphate. The reaction was started with YeiN (1 µM for the ΨMP synthesis, 3 µM for the dΨMP synthesis and 90 µM for the synthesis using Ura derivatives). ΨMP phosphorylation was started with 15 mM PEP, 15 µM CMPK, and 1 mM ATP, resulting in a volume increase of 33%. Ten microliters of samples were quenched by addition of 100 μL methanol and precipitated protein was removed by centrifugation for 20,000 × g for 5 min prior to HPLC analysis. Enzymes were heat inactivated (5 min, 99 °C) after 21 h reaction and precipitated protein was removed by centrifugation for 10 min at 4 °C and 16,000 × g. Dephosphorylation of pentose 5-phosphates BT4131 (10 µM) and 1 mM MgCl2 were added to the reaction mixtures and incubated for 60 min of at 37 °C. The reaction was stopped by heat inactivation (5 min, 99 °C) and precipitated protein was removed by centrifugation for 10 min at 4 °C and 16,000 × g. Anion exchange chromatography Enzyme-free reaction mixture was applied (20 mL; 2 mL/min) to a FliQ FPLC column (10 mL; 104 × 11.0 mm; Generon, Maidenhead, U.K.) packed with SuperQ-650M (Tosh, Tokyo, Japan) anion exchange resin mounted onto an ÄKTA prime plus FPLC system (GE Healthcare.). The column was equilibrated in 10 mM NaAc, pH 4.5. Products were eluted using a linear gradient of 1 M NaAc, pH 4.5, from 0% to 50% in 120 mL with a flow of 4 mL/min and monitored at 260 nm. Following product elution, buffer B was set to 100% for 10 min to elute unspecifically bound substances. The fractions containing the desired C-nucleoside were pooled and concentrated under reduced pressure (20 mbar, 40 °C) to a total volume of 10 mL using a rotary evaporator (Laborta 500-efficient; Heidolph Instruments, Schwabach, Germany). Size exclusion chromatography To remove excess NaAc, concentrated products were split in 5 × 2 mL portions and loaded onto a size exclusion column (16 × 1000 mm; XR 16/100 column; GE Healthcare) packed with Sephadex G10 (exclusion limit <700 Da) equilibrated in double distilled H2O and mounted onto an ÄKTA prime plus FPLC system (GE Healthcare). Compound elusion was performed using doubly distilled water and monitored at 260 nm. Fractions containing salt-free product were collected, pooled and concentrated under reduced pressure (20 mbar, 40 °C) to a total volume of 10 mL using a rotary evaporator (Laborta 500-efficient; Heidolph Instruments) and lyophilized. Docking Molecular docking was used to structurally evaluate the substrate scope of YeinN. AutoDock13 90 as implemented in Yasara v. 18.2.7 was used for enzyme-ligand docking. The AmberFB-15 91 force field and the default parameters provided by the standard docking macro were used. The structure of YeiN (pdb code: 4GIL) 62 was used as a receptor in molecular-docking experiments. For dockings of sugar phosphates (d-Rib5P (1), d-Rul5P (10), d-Fru6P (9), d-Glu6P (7), d-Ery4P(11)), the ring-opened intermediate was deleted and a simulation cell of 15 Å × 10 Å × 10 Å was placed at the former location of d-Rib5P (1). Sugar phosphates were docked in the ring-open conformation. The protonation state of key catalytic residues (Glu31 protonated; Lys166 deprotonated) was set prior to the docking experiment. The protonation states of all other protein residues were set automatically for a pH of 7.00. For dockings of nucleobases (Ura (12), 6-trifluoro-methyl-Ura (19), 6-Cl-Ura (22), 6-aza-Ura (21), 1-methyl-Ura (17), 5-fluoro-Ura (18), 5-methyl-Ura(20)), the uracil moiety was deleted and the charge of lysine was set to fit the covalent iminium intermediate. The protonation states of all other protein residues were set automatically for a pH of 7.00. A simulation cell of 15 Å × 10 Å × 10 Å was placed at the former location of Ura (11). Following the docking runs, the obtained poses were optimized by energy using the standard macro included in Yasara. All ligands were generated using the Grade Web Server ( http://grade.globalphasing.org/cgi-bin/grade/server.cgi ) 92 . Docking poses were evaluated by their associated free energy and mechanistic plausibility. Synthesis of pseudouridinated RNA In vitro translation (IVT) using T7 RNA polymerase (Thermo Fisher Scientific) was performed following the manufacturer’s protocol. Shortly, linear DNA template containing the T7 promoter and the yein gene was amplified from the YeiN expression vector (peT15_yein) by PCR using Phusion polymerase and a set of primers complementary to the T7 promoter (TAATACGACTCACTATAGGG) or terminator (GCTAGTTATTGCTCAGCGG). The PCR product was purified via column purification (GenJET® PCR clean up; Thermo Fisher Scientific) and eluted in DEPC-water. IVT was performed using 30 U of T7 RNA polymerase, 600 ng template DNA, Transcription Buffer (40 mM Tris-HCl pH 7.9, at 25 °C), 6 mM MgCl2, 10 mM DTT, 10 mM NaCl and 2 mM spermidine) and 2 mM of each NTP (ATP, GTP, UTP, CTP) in a total volume of 50 µL. Synthesis of modified RNA was performed in two ways; either 2 mM of ΨTP (or: dΨTP, 6-amino-ΨTP) was additionally added to the conventional NTPs or, UTP was fully replaced by 2 mM of either ΨTP, dΨTP or 6-amino-ΨTP. The reaction was incubated at 37 °C in the thermocycler (Doppio-Dual; VWR, Radnor, PA, USA) and the resulting PCR products were evaluated by agarose gel electrophoresis. Synthesis of pseudouridinated DNA To evaluate the potential of PCR catalyzed generation of pseudouridinated DNA, the yein gene was amplified from 50 ng expression vector (pet15_yein) using 1.25 U of Dream-Taq DNA polymerase, 0.2 mM of dNTPs (dATP, dCTP, dGTP, dTTP), 0.5 µM T7_fwd, 0.5 µM T7_bwd primers and DreamTaq Buffer as recommended by the supplier (Thermo Fisher Scientific). To incorporate Ψ into the DNA either 0.2 mM of ΨTP were additionally added to dNTP mix or fully replaced dTTP by dΨTP. The temperature profile consisted of a preheating step at 95 °C for 1 min, followed by 30 reaction cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 2 min. The final extension step was carried out at 72 °C for 5 min. PCRs were performed using the Doppio-Dual thermocycler (VWR). The resulting PCR products were evaluated by agarose gel electrophoresis. In situ 1H-NMR of ΨMP synthesis or hydrolysis YeiN-catalyzed synthesis of ΨMP from d-Rib5P (1) and Ura (12), as well as hydrolysis of ΨMP, were analyzed by 1H-NMR. All reagents including the enzyme were dissolved in D2O and the reaction was set up in a 5 mm high-precision NMR sample tube (Promochem, Wesel, Germany). YeiN was buffered by washing the enzyme with 10-fold excess of 10 mM potassium phosphate buffer (pD 7.5) supplemented with 0.1 mM MnCl2, using centrifugation (16,000 × g, 15 min, 4 °C) with Vivaspin 500 centrifugal concentrators (10 kDa cut-off). The synthesis reaction contained 14 mM Ura (12) and 8 mM d-Rib5P (1), while 10 mM ΨMP were used for the hydrolysis reaction. Each reaction was initiated by adding 3 µM enzyme. The reactions were incubated at 30 °C without agitation in the electromagnetic field. Measurements were performed with a Varian INOVA 500-MHz NMR spectrometer (Agilent Technologies; Santa Clara, CA, USA). The VNMRJ 2.2D software was used for all measurements. 1H-NMR spectra (499.98 MHz) were recorded on a 5 mm indirect detection PFG-probe with pre-saturation of the water signal by a shaped pulse. The following standard pre-saturation sequence was used: 2 s relaxation delay; 90° proton pulse; 2.048 s acquisition time; 8 kHz spectral width; number of points 32 k. 1H-NMR analysis of YeiN-catalyzed deuterium exchange The potential of YeiN-catalyzed deuterium wash-in into Ura (12) without transient formation of ΨMP was evaluated by 1H-NMR. All reagents including the enzyme were dissolved in D2O and prepared as described above. The 600 µL reactions contained 5 mM Ura (12) and 5 mM of sugar phosphate (d-Rib5P (1), d-Ery4P (11), d-Rul5P (10), d-Glc6P (7), d-Fru6P(9)) in 10 mM potassium phosphate buffer (pD 7.5) supplemented with 0.1 mM MnCl2. Conversions were started by addition of 3 µM enzyme and incubated at 30 °C in a Thermomixer comfort (Eppendorf, Hamburg, Germany) with agitation of 300 rpm for 3 h. The reactions were stopped by heat treatment (5 min, 99 °C) and precipitated protein was removed by centrifugation for 10 min at 4 °C and 16,000 × g. The supernatant was transferred into a 5 mm NMR sample tube and analyzed by 1H-NMR. NMR analysis of purified reaction products Lyophilized products were dissolved to 3−10 mM in 50 mM potassium phosphate buffer (pD 7.9) in a total volume of 600 μL and transferred to a 5 mm high-precision NMR sample tube. They were analyzed using a Varian INOVA 500-MHz NMR spectrometer (Agilent Technologies). The VNMRJ 2.2D software was used for measurements. 1H-NMR spectra (499.98 MHz) were measured on a 5 mm indirect detection PFG probe. Standard pre-saturation sequence was used: relaxation delay 2 s; 908 proton pulse; 2.048 s acquisition time; spectral width 8 kHz; number of points 32,000 13C NMR spectra (125.71 MHz). Standard pre-saturation sequence was used: relaxation delay 2 s; 908 proton pulse; 2.048 s acquisition time; spectral width 8 kHz; number of points 32 k. MNova 12.0.3 (Mestrelab Research S.L. Bajo, Santiago de Compostela, Spain) was used for data processing and analysis (Supplementary Figs. 10 – 29 ). Recorded spectra were in good agreement with published data 75 . Reporting summary Further information on research design is available in the  Nature Research Reporting Summary linked to this article. Data availability All relevant data are reported in the manuscript and in the associated  Supplementary Information . All data are available from the corresponding author upon reasonable request. There is no restriction on data availability. Source data are provided with this paper. References 1. Evans, G. B. et al. 8-Aza-immucillins as transition-state analogue inhibitors of purine nucleoside phosphorylase and nucleoside hydrolases. J. Med. Chem. 46, 155–160 (2003). 2. Kicska, G. A. et al. Immucillin H, a powerful transition-state analog inhibitor of purine nucleoside phosphorylase, selectively inhibits human T lymphocytes. Proc. Natl Acad. Sci. 98, 4593–4598 (2001). 3. Miles, R. W., Tyler, P. C., Furneaux, R. H., Bagdassarian, C. K. & Schramm, V. L. One-third-the-sites transition-state inhibitors for purine nucleoside phosphorylase. Biochemistry 37, 8615–8621 (1998). 4. Berg, M. et al. Evaluation of nucleoside hydrolase inhibitors for treatment of african trypanosomiasis. Antimicrob. Agents Chemother. 54, 1900–1908 (2010). 5. Jan, Š., Hocek, M. & Pavel, K. C-Nucleosides: synthetic strategies and biological applications. Chem. Rev. 109, 6729–6764 (2009). 6. Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K. & Růžek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antivir. Chem. Chemother. 26, 2040206618761299 (2018). 7. Warren, T. K. et al. Protection against filovirus diseases by a novel broad-spectrum nucleoside analogue BCX4430. Nature 508, 402–405 (2014). 9. Rosenqvist, P. et al. Characterization of C-nucleoside antimicrobials from Streptomyces albus DSM 40763: strepturidin is pseudouridimycin. Sci. Rep. 9, 1–9 (2019). 10. Li, G. & Clercq, E. D. Therapeutic options for the 2019 novel coronavirus (2019-nCoV). Nat. Rev. Drug Discov. 19, 149–150 (2020). 11. Zumla, A., Chan, J. F. W., Azhar, E. I., Hui, D. S. C. & Yuen, K.-Y. Coronaviruses—drug discovery and therapeutic options. Nat. Rev. Drug Discov. 15, 327–347 (2016). 12. Warren, T. K. et al. Therapeutic efficacy of the small molecule GS-5734 against Ebola virus in rhesus monkeys. Nature 531, 381–385 (2016). 13. Wang, M. et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 30, 269–271 (2020). 14. Li, Z. et al. Rapid review for the anti-coronavirus effect of remdesivir. Drug Discov. Ther. 14, 73–76 (2020). 15. Kong, L. et al. Divergent biosynthesis of C-nucleoside minimycin and indigoidine in bacteria. iScience 22, 430–440 (2019). 16. Roy-Burman, S., Roy-Burman, P. & Visser, D. W. Showdomycin, a new nucleoside antibiotic. Cancer Res. 28, 1605–1610 (1968). Maffioli, S. I. et al. Antibacterial nucleoside-analog inhibitor of bacterial RNA polymerase. Cell 169, 1240–1248 (2017). 18. Sosio, M. et al. Analysis of the pseudouridimycin biosynthetic pathway provides insights into the formation of C-nucleoside antibiotics. Cell Chem. Biol. 25, 540–549 (2018). e4. 19. Ren, D. et al. Identification of the C-glycoside synthases during biosynthesis of the pyrazole-C-nucleosides formycin and pyrazofurin. Angew. Chem. Int. Ed. 58, 16512–16516 (2019). 20. Palmu, K. et al. Discovery of the showdomycin gene cluster from Streptomyces showdoensis ATCC 15227 yields Insight into the biosynthetic logic of C-nucleoside antibiotics. ACS Chem. Biol. 12, 1472–1477 (2017). 21. Gao, S. et al. Uncovering the chemistry of C–C bond formation in C-nucleoside biosynthesis: crystal structure of a C-glycoside synthase/PRPP complex. Chem. Commun. 56, 7617–7620 (2020). 22. Carlile, T. M. et al. Pseudouridine profiling reveals regulated mRNA pseudouridylation in yeast and human cells. Nature 515, 143–146 (2014). 23. Harcourt, E. M., Kietrys, A. M. & Kool, E. T. Chemical and structural effects of base modifications in messenger RNA. Nature 541, 339–346 (2017). 24. Charette, M. & Gray, M. W. Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49, 341–351 (2000). 25. Li, X., Ma, S. & Yi, C. Pseudouridine: the fifth RNA nucleotide with renewed interests. Curr. Opin. Chem. Biol. 33, 108–116 (2016). 26. Spenkuch, F., Motorin, Y. & Helm, M. Pseudouridine: still mysterious, but never a fake (uridine)! RNA Biol. 11, 1540–1554 (2014). 28. Veerareddygari, G. R., Singh, S. K. & Mueller, E. G. The pseudouridine synthases proceed through a glycal intermediate. J. Am. Chem. Soc. 138, 7852–7855 (2016). 29. Mandal, P. K. & Rossi, D. J. Reprogramming human fibroblasts to pluripotency using modified mRNA. Nat. Protoc. 8, 568–582 (2013). 30. Uchida, S., Kataoka, K. & Itaka, K. Screening of mRNA chemical modification to maximize protein expression with Rreduced immunogenicity. Pharmaceutics 7, 137–151 (2015). 31. Karikó, K. et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. 16, 1833–1840 (2008). 32. Karikó, K., Muramatsu, H., Keller, J. M. & Weissman, D. Increased erythropoiesis in mice injected with submicrogram quantities of pseudouridine-containing mRNA encoding erythropoietin. Mol. Ther. 20, 948–953 (2012). 33. Eyler, D. E. et al. Pseudouridinylation of mRNA coding sequences alters translation. Proc. Natl Acad. Sci. 116, 23068–23074 (2019). 34. Karijolich, J. & Yu, Y.-T. Converting nonsense codons into sense codons by targeted pseudouridylation. Nature 474, 395–398 (2011). 35. Hoernes, T. P. et al. Nucleotide modifications within bacterial messenger RNAs regulate their translation and are able to rewire the genetic code. Nucleic Acids Res. 44, 852–862 (2016). 36. Fernández, I. S. et al. Unusual base pairing during the decoding of a stop codon by the ribosome. Nature 500, 107–110 (2013). 37. Li, B. et al. Engineering CRISPR–Cpf1 crRNAs and mRNAs to maximize genome editing efficiency. Nat. Biomed. Eng. 1, 1–10 (2017). 38. Vaidyanathan, S. et al. Uridine depletion and chemical modification increase Cas9 mRNA activity and reduce Iimmunogenicity without HPLC purification. Mol. Ther. Nucleic Acids 12, 530–542 (2018). 39. Temburnikar, K. & Seley-Radtke, K. L. Recent advances in synthetic approaches for medicinal chemistry of C-nucleosides. Beilstein J. Org. Chem. 14, 772–785 (2018). 40. Daves, G. D. & Cheng, C. C. in Progress in Medicinal Chemistry (eds. Ellis, G. P. & West, G. B.) Vol. 13, 303–349 (Elsevier, 1976). 41. Hacksell, U. & Daves, G. D. in Progress in Medicinal Chemistry (eds. Ellis, G. P. & West, G. B.) Vol. 22, 1–65 (Elsevier, 1985). 42. Meanwell, M. et al. A short de novo synthesis of nucleoside analogs. Science 369, 725–730 (2020). 43. Xue, F. et al. Improvement of the C-glycosylation step for the synthesis of remdesivir. Org. Process Res. Dev. 24, 1772–1777 (2020). Rights and permissions Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ .